MCQ Questions
Q.1.
If a segment of DNA were replicated without any errors, the replicated strand would have the following sequence of nucleotides:5' - ACTACGTGA - 3'Sort the following replicated DNA sequences by the type of point mutation each contains (frameshift, base substitution, or neither), as compared to the correct sequence shown above.
  • 0%
    Two.The second and third codons in the new sequence are different from the original codons.
  • 0%
    mRNA: 5'AUGCUGGAGGGGGUUAGACAU3' Protein: Met-Leu-Glu-Gly-Val-Arg-His
  • 0%
    An addition mutation and a deletion mutation.If the mutations occur within the same codon, only that codon (amino acid) will be altered.
  • 0%
    Frameshift:5'-ACTCGTGA-3', 5'-ACTTACGTGA-3'Base Substitution: 5'-ACTACGTGT-3', 5'-ACTAAGTGA-3'
Q.2.
Consider the following section of mRNA:UCUGAUGGGCUUUBeginning with the start codon, which amino acids, in order, are coded for by this section of mRNA? Consult the codon table provided if necessary.
  • 0%
    methionine, glycine, phenylalanine
  • 0%
    mRNA: 5'AUGCUGGAGGGGGUUAGACAU3' Protein: Met-Leu-Glu-Gly-Val-Arg-His
  • 0%
    3' AAA-GAA-TAA-CAA 5'
  • 0%
    Deletion. The original sequence has lost the base C.
Q.3.
A particular triplet of bases in the template strand of DNA is 5' AGT 3'. The corresponding codon for the mRNA transcribed is _____.
  • 0%
    3' AAA-GAA-TAA-CAA 5'
  • 0%
    Start codon: AUG; stop codon: UAA; protein: Met-Ala-Leu-stop. The start codon is AUG, and there are three possible stop codons: UAA, UAG, and UGA.
  • 0%
    AAA.Changing the first base from A—>U creates the stop codon UAA.
  • 0%
    3' UCA 5'
Q.4.
Codons are part of the molecular structure of _____.
  • 0%
    is a nonsense mutation.
  • 0%
    cytoplasm. RNA must leave the nucleus for translation.
  • 0%
    mRNA
  • 0%
    A knock-out mutation results in a total absence of the mutated protein.
Q.5.
If the sequence ATGCATGTCAATTGA were mutated such that a base were inserted after the first G and the third T were deleted, how many amino acids would be changed in the mutant protein?
  • 0%
    Frameshift:5'-ACTCGTGA-3', 5'-ACTTACGTGA-3'Base Substitution: 5'-ACTACGTGT-3', 5'-ACTAAGTGA-3'
  • 0%
    Two.The second and third codons in the new sequence are different from the original codons.
  • 0%
    mRNA: 5'AUGCUGGAGGGGGUUAGACAU3' Protein: Met-Leu-Glu-Gly-Val-Arg-His
  • 0%
    Deletion. The original sequence has lost the base C.
Q.6.
A mutation that results in premature termination of translation _____.
  • 0%
    A knock-out mutation results in a total absence of the mutated protein.
  • 0%
    3' AAA-GAA-TAA-CAA 5'
  • 0%
    is a nonsense mutation.
  • 0%
    Deletion. The original sequence has lost the base C.
Q.7.
Each codon shown below specifies an amino acid. For which one is it possible that a change in a single base could create a stop codon?
  • 0%
    A knock-out mutation results in a total absence of the mutated protein.
  • 0%
    AAA.Changing the first base from A—>U creates the stop codon UAA.
  • 0%
    mRNA: 5'AUGCUGGAGGGGGUUAGACAU3' Protein: Met-Leu-Glu-Gly-Val-Arg-His
  • 0%
    Two.The second and third codons in the new sequence are different from the original codons.
Q.8.
All three domains (Bacteria, Archaea, and Eukarya) follow the same genetic code. Therefore, which of the following statements would most likely be correct?
  • 0%
    AAA.Changing the first base from A—>U creates the stop codon UAA.
  • 0%
    The genetic code evolved before the different domains diverged.
  • 0%
    False
  • 0%
    Two.The second and third codons in the new sequence are different from the original codons.